ID: 969517633_969517642

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 969517633 969517642
Species Human (GRCh38) Human (GRCh38)
Location 4:7656462-7656484 4:7656515-7656537
Sequence CCTCATGTCACAGGGAAGAACTG CACAGGAGGGAACTGAGGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 252} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!