ID: 969537323_969537331

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 969537323 969537331
Species Human (GRCh38) Human (GRCh38)
Location 4:7764643-7764665 4:7764691-7764713
Sequence CCATCCACAGGCCCTGAGTGCTG GTGCCAGCACTGTGAAAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 332} {0: 1, 1: 0, 2: 2, 3: 21, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!