ID: 969619159_969619165

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 969619159 969619165
Species Human (GRCh38) Human (GRCh38)
Location 4:8270255-8270277 4:8270290-8270312
Sequence CCTATGCCAACGTGTGCGCGCTG CGCCGCGCGCTGCAGCTCTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 33} {0: 1, 1: 0, 2: 2, 3: 9, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!