ID: 969669401_969669410

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 969669401 969669410
Species Human (GRCh38) Human (GRCh38)
Location 4:8581472-8581494 4:8581516-8581538
Sequence CCTGAGCGTCCGCGCTTCGCAGC CGTGGGCTTCGTGCTGCCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 44} {0: 1, 1: 0, 2: 2, 3: 9, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!