ID: 969733777_969733784

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 969733777 969733784
Species Human (GRCh38) Human (GRCh38)
Location 4:8973408-8973430 4:8973443-8973465
Sequence CCACACCCAGTTGGACCCACATG TGCAAAGGCTAAACCGAGACAGG
Strand - +
Off-target summary No data {0: 26, 1: 25, 2: 18, 3: 8, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!