ID: 969739862_969739864

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 969739862 969739864
Species Human (GRCh38) Human (GRCh38)
Location 4:9016340-9016362 4:9016364-9016386
Sequence CCTGCTCTAGTAATTGAGAAGAC GTCTCTAGAATATGATTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 2, 3: 10, 4: 136} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!