ID: 969826785_969826791

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 969826785 969826791
Species Human (GRCh38) Human (GRCh38)
Location 4:9764106-9764128 4:9764153-9764175
Sequence CCCTGGAGCCGCCTTCCTCTGGA ATGTTGTCATTGTTCAAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 0, 3: 30, 4: 206} {0: 7, 1: 0, 2: 1, 3: 20, 4: 229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!