ID: 970012144_970012150

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 970012144 970012150
Species Human (GRCh38) Human (GRCh38)
Location 4:11470866-11470888 4:11470915-11470937
Sequence CCAGATCAGCCAGGGAACGGCTT GACCTGGAAGGATGACAGAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 34, 4: 347}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!