ID: 970104976_970104982

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 970104976 970104982
Species Human (GRCh38) Human (GRCh38)
Location 4:12571926-12571948 4:12571952-12571974
Sequence CCTCTCCACTTTTTTTCATTCCA TGCTCACCTGCATCTTGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 33, 3: 466, 4: 3561} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!