ID: 970155687_970155691

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 970155687 970155691
Species Human (GRCh38) Human (GRCh38)
Location 4:13139757-13139779 4:13139809-13139831
Sequence CCAGCTCCATCAGTGAATAGAGC GCCTCCTTCACAGGAGCACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 103} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!