ID: 970355215_970355224

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 970355215 970355224
Species Human (GRCh38) Human (GRCh38)
Location 4:15244756-15244778 4:15244799-15244821
Sequence CCTATTGGGTCCTTGCCACATTT GGGATAAGGTCAAGGTTGGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 6, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!