ID: 970355217_970355225

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 970355217 970355225
Species Human (GRCh38) Human (GRCh38)
Location 4:15244771-15244793 4:15244800-15244822
Sequence CCACATTTCAGTCAATGTGTCTG GGATAAGGTCAAGGTTGGCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 18, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!