ID: 970536638_970536642

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 970536638 970536642
Species Human (GRCh38) Human (GRCh38)
Location 4:17036654-17036676 4:17036696-17036718
Sequence CCACCACACTCGGCTAATTTTTA GACCCACTATGTGCTCAGGCTGG
Strand - +
Off-target summary {0: 68, 1: 2304, 2: 26366, 3: 119501, 4: 209282} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!