ID: 970709306_970709308

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 970709306 970709308
Species Human (GRCh38) Human (GRCh38)
Location 4:18843123-18843145 4:18843150-18843172
Sequence CCATGTACAAGAAGAATGAAGTT GGACAACCAAAGAGTGAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 15, 3: 85, 4: 440} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!