ID: 971039874_971039876

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 971039874 971039876
Species Human (GRCh38) Human (GRCh38)
Location 4:22740072-22740094 4:22740086-22740108
Sequence CCACTGGAGAGTGGGGGTGGTGG GGGTGGTGGTACTGAAGTCATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!