ID: 971151821_971151829

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 971151821 971151829
Species Human (GRCh38) Human (GRCh38)
Location 4:24041279-24041301 4:24041295-24041317
Sequence CCCTCCAACTCCTCCCTGCTGGG TGCTGGGCACAGTTTAGAAAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!