ID: 971263639_971263642

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 971263639 971263642
Species Human (GRCh38) Human (GRCh38)
Location 4:25078735-25078757 4:25078766-25078788
Sequence CCCTGGTGTATTAGTCTGTTTTC TGTGAAGACATACCATAGGCTGG
Strand - +
Off-target summary {0: 10, 1: 29, 2: 145, 3: 405, 4: 928} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!