ID: 971263640_971263642

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 971263640 971263642
Species Human (GRCh38) Human (GRCh38)
Location 4:25078736-25078758 4:25078766-25078788
Sequence CCTGGTGTATTAGTCTGTTTTCA TGTGAAGACATACCATAGGCTGG
Strand - +
Off-target summary {0: 19, 1: 127, 2: 497, 3: 1003, 4: 1388} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!