ID: 971393065_971393073

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 971393065 971393073
Species Human (GRCh38) Human (GRCh38)
Location 4:26203938-26203960 4:26203972-26203994
Sequence CCTTAAAATGAAGCCAGATGATC GTCTCACTCTCCCACGGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 204} {0: 1, 1: 0, 2: 4, 3: 171, 4: 4099}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!