ID: 971460367_971460373

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 971460367 971460373
Species Human (GRCh38) Human (GRCh38)
Location 4:26889615-26889637 4:26889660-26889682
Sequence CCATATCAGGGACTCATTATTGG CCTCATTAGCACCTGTAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 46, 4: 226} {0: 1, 1: 0, 2: 1, 3: 9, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!