ID: 971817990_971817996

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 971817990 971817996
Species Human (GRCh38) Human (GRCh38)
Location 4:31514532-31514554 4:31514584-31514606
Sequence CCTCTTAAACTGCACCAAGAAAA TCCCATTAGGGCTCACTTAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 235} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!