ID: 971921667_971921670

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 971921667 971921670
Species Human (GRCh38) Human (GRCh38)
Location 4:32948302-32948324 4:32948326-32948348
Sequence CCTAAAATTCATATGGAACCAAA AAAGCCTACATAGGTAAAGCAGG
Strand - +
Off-target summary {0: 539, 1: 941, 2: 1416, 3: 1981, 4: 2742} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!