ID: 971938982_971938993

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 971938982 971938993
Species Human (GRCh38) Human (GRCh38)
Location 4:33189444-33189466 4:33189493-33189515
Sequence CCTGGCAGCCCTCAGGGTGGTGG TCCCTGTGCTCTCCCTGCAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 5, 3: 77, 4: 454}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!