ID: 972322925_972322931

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 972322925 972322931
Species Human (GRCh38) Human (GRCh38)
Location 4:37989438-37989460 4:37989472-37989494
Sequence CCCTAAAATGTATAAAGCAAGCT CACCTTGAGCACGTGTTCTCAGG
Strand - +
Off-target summary {0: 5, 1: 10, 2: 31, 3: 82, 4: 672} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!