ID: 972322926_972322931

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 972322926 972322931
Species Human (GRCh38) Human (GRCh38)
Location 4:37989439-37989461 4:37989472-37989494
Sequence CCTAAAATGTATAAAGCAAGCTA CACCTTGAGCACGTGTTCTCAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 17, 3: 61, 4: 411} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!