ID: 972333812_972333818

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 972333812 972333818
Species Human (GRCh38) Human (GRCh38)
Location 4:38087667-38087689 4:38087687-38087709
Sequence CCCCGTCTCAACTGAAAATACAG CAGAAATTAGCAGGGCATGGTGG
Strand - +
Off-target summary {0: 2, 1: 90, 2: 5492, 3: 114690, 4: 226752} {0: 11, 1: 1365, 2: 36718, 3: 113208, 4: 194357}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!