ID: 972352459_972352464

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 972352459 972352464
Species Human (GRCh38) Human (GRCh38)
Location 4:38248678-38248700 4:38248716-38248738
Sequence CCCAGCACTTTGGGAGGCCAAGG TCAGGAGATCGAGACCATCCTGG
Strand - +
Off-target summary {0: 84285, 1: 209100, 2: 236161, 3: 152470, 4: 88713} {0: 52576, 1: 63017, 2: 95022, 3: 179642, 4: 170031}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!