ID: 972352462_972352465

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 972352462 972352465
Species Human (GRCh38) Human (GRCh38)
Location 4:38248695-38248717 4:38248725-38248747
Sequence CCAAGGCGCGCTGATCATGAGTC CGAGACCATCCTGGCTAATATGG
Strand - +
Off-target summary No data {0: 922, 1: 39336, 2: 59262, 3: 100394, 4: 181947}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!