ID: 972458861_972458867

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 972458861 972458867
Species Human (GRCh38) Human (GRCh38)
Location 4:39280491-39280513 4:39280528-39280550
Sequence CCTACAAAAAAATAATTAGCCAG ACCTGTAGTCCCCGCTGCTTGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 48, 3: 266, 4: 3639} {0: 4, 1: 638, 2: 17886, 3: 104652, 4: 249904}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!