|
Left Crispr |
Right Crispr |
Crispr ID |
972458861 |
972458869 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
4:39280491-39280513
|
4:39280531-39280553
|
Sequence |
CCTACAAAAAAATAATTAGCCAG |
TGTAGTCCCCGCTGCTTGGGAGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 2, 2: 48, 3: 266, 4: 3639} |
{0: 8, 1: 1774, 2: 49232, 3: 164906, 4: 239284} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|