ID: 972516983_972516988

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 972516983 972516988
Species Human (GRCh38) Human (GRCh38)
Location 4:39818236-39818258 4:39818261-39818283
Sequence CCAAGCTGTGTATGTGTAGAGAG GAAAATGAGGCCGGGCGCGGTGG
Strand - +
Off-target summary No data {0: 7, 1: 110, 2: 1137, 3: 5609, 4: 19578}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!