ID: 972582681_972582687

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 972582681 972582687
Species Human (GRCh38) Human (GRCh38)
Location 4:40408822-40408844 4:40408853-40408875
Sequence CCTGCTTCAGGCGCCCTAGTAGC CAGGTGCACACCACCACACCCGG
Strand - +
Off-target summary No data {0: 998, 1: 5526, 2: 20193, 3: 47639, 4: 91260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!