ID: 972663265_972663269

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 972663265 972663269
Species Human (GRCh38) Human (GRCh38)
Location 4:41138479-41138501 4:41138520-41138542
Sequence CCAATAAAGAGCTTATATCAGAC CCCAATATAAAAATGGGCAAAGG
Strand - +
Off-target summary No data {0: 2, 1: 107, 2: 513, 3: 1753, 4: 10832}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!