|
Left Crispr |
Right Crispr |
| Crispr ID |
972701609 |
972701617 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:41499559-41499581
|
4:41499574-41499596
|
| Sequence |
CCTATAATTCTAGCACTTTGGAA |
CTTTGGAAGGGCAAGGTGGGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 10, 1: 432, 2: 8397, 3: 81139, 4: 362953} |
{0: 8, 1: 1132, 2: 25663, 3: 79938, 4: 159545} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|