ID: 972910505_972910507

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 972910505 972910507
Species Human (GRCh38) Human (GRCh38)
Location 4:43810570-43810592 4:43810616-43810638
Sequence CCATCTCAAAAAAAAAAAGAAAA GACCCACAGCTCCACATGGCTGG
Strand - +
Off-target summary {0: 1386, 1: 87388, 2: 68022, 3: 80236, 4: 142131} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!