ID: 973272127_973272139

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 973272127 973272139
Species Human (GRCh38) Human (GRCh38)
Location 4:48271904-48271926 4:48271946-48271968
Sequence CCTAACAGACCTCAGACCGGTAC TGGGGAACCCTGATTTAACAGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 48, 3: 388, 4: 807} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!