ID: 973633329_973633330

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 973633329 973633330
Species Human (GRCh38) Human (GRCh38)
Location 4:52839667-52839689 4:52839689-52839711
Sequence CCATTAGAGATCTGGAGAAGCTA ATCATTTGATTTCTCCTCCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 26, 4: 321}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!