ID: 974143564_974143573

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 974143564 974143573
Species Human (GRCh38) Human (GRCh38)
Location 4:57919147-57919169 4:57919195-57919217
Sequence CCTCCTCAAGCTGTGGTGGGGTC TTTGTTTACCTAAGCAAGCCTGG
Strand - +
Off-target summary No data {0: 1980, 1: 1027, 2: 323, 3: 107, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!