ID: 974143564_974143574

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 974143564 974143574
Species Human (GRCh38) Human (GRCh38)
Location 4:57919147-57919169 4:57919196-57919218
Sequence CCTCCTCAAGCTGTGGTGGGGTC TTGTTTACCTAAGCAAGCCTGGG
Strand - +
Off-target summary No data {0: 1960, 1: 1038, 2: 682, 3: 307, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!