ID: 974190479_974190486

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 974190479 974190486
Species Human (GRCh38) Human (GRCh38)
Location 4:58496513-58496535 4:58496555-58496577
Sequence CCAGATCCAGAGGGGTGGAAGTC TGGCGATCAGCAGTGGTGGACGG
Strand - +
Off-target summary {0: 28, 1: 72, 2: 82, 3: 94, 4: 145} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!