ID: 974725958_974725963

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 974725958 974725963
Species Human (GRCh38) Human (GRCh38)
Location 4:65798820-65798842 4:65798838-65798860
Sequence CCACTGGCCAAATCATATCAGAT CAGATGGCTGGGCCTAGAATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 210} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!