ID: 974736381_974736383

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 974736381 974736383
Species Human (GRCh38) Human (GRCh38)
Location 4:65938728-65938750 4:65938745-65938767
Sequence CCTGGGCCTTGATCTTGGACTTC GACTTCGTAGCCTCCAGAATTGG
Strand - +
Off-target summary {0: 14, 1: 241, 2: 1132, 3: 2187, 4: 3006} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!