ID: 974874397_974874410

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 974874397 974874410
Species Human (GRCh38) Human (GRCh38)
Location 4:67685625-67685647 4:67685663-67685685
Sequence CCCCGTTACGTAGGACCTAATGG GGGAGGTGTTTAGGTCATGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 8} {0: 51, 1: 536, 2: 1995, 3: 4419, 4: 7815}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!