ID: 974874399_974874407

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 974874399 974874407
Species Human (GRCh38) Human (GRCh38)
Location 4:67685626-67685648 4:67685654-67685676
Sequence CCCGTTACGTAGGACCTAATGGG TTGCCTAGTGGGAGGTGTTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 15} {0: 1, 1: 11, 2: 257, 3: 1271, 4: 2097}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!