ID: 974874401_974874405

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 974874401 974874405
Species Human (GRCh38) Human (GRCh38)
Location 4:67685627-67685649 4:67685643-67685665
Sequence CCGTTACGTAGGACCTAATGGGA AATGGGAGGTGTTGCCTAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 40} {0: 1, 1: 0, 2: 1, 3: 35, 4: 417}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!