|
Left Crispr |
Right Crispr |
| Crispr ID |
974874403 |
974874410 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:67685640-67685662
|
4:67685663-67685685
|
| Sequence |
CCTAATGGGAGGTGTTGCCTAGT |
GGGAGGTGTTTAGGTCATGAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 2, 2: 8, 3: 113, 4: 1058} |
{0: 51, 1: 536, 2: 1995, 3: 4419, 4: 7815} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|