ID: 975033769_975033773

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 975033769 975033773
Species Human (GRCh38) Human (GRCh38)
Location 4:69656957-69656979 4:69656989-69657011
Sequence CCGGGAGGTGGAAAGCCTCAGGC AGCAGGGCTCACCCTCCACCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 37, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!