ID: 975033777_975033784

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 975033777 975033784
Species Human (GRCh38) Human (GRCh38)
Location 4:69657004-69657026 4:69657021-69657043
Sequence CCACCTGGAAACAGACTCCAGGT CCAGGTTGTTGAGGGGGACACGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!