ID: 975065830_975065836

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 975065830 975065836
Species Human (GRCh38) Human (GRCh38)
Location 4:70062370-70062392 4:70062419-70062441
Sequence CCACTGGTAACTTTTATCTTTAG CCTGAAGATGGGCAACCACACGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!