ID: 975301671_975301685

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 975301671 975301685
Species Human (GRCh38) Human (GRCh38)
Location 4:72797748-72797770 4:72797795-72797817
Sequence CCACCATTCTGGGGTCTAGAGGG ACTAGGCAGTTTCCCAGTGGGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 43, 3: 86, 4: 154} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!